Garden of Eden and Utopia Essay

Everyone has an ideal world in which they’d want to live in. Of course no one wants to live in a place in which there is violence, cruelty, bad energy etc. But, for some, in order to achieve their ideal perfection of a utopia; they must do anything in their power to get close to what they have envisioned there ideal place would be like. Sure, some may say there is no such thing as perfection, others think otherwise. With variety of opinions whether a utopia can exist there many conflicts too many opinions and believes. Filmed by the director Guillermo Del Toro â€Å"Pan’s Labyrinth, section of Walden by Henry Thoreau and Genesis three, shows how dystopia is introduced as the story goes along. Because so many want to achieve utopia, many believe that the idea of having a perfect society does not exist and eventually will turn into chaos. In the movie Pan’s Labyrinth, the idea of a perfect utopia was displayed by one, going back to the years after the Spanish Civil War, in which â€Å"La guerilla† (the rebels) tries to fight the military of Spain. The purpose for the rebels to fight off the Regime was to oppose to the new government that wanted to control and create a New Spain. These rebels were not happy since they had different believes that the new government was strongly to oppose which was equality. Because both were displeased a war broke out and Spain was in war with itself. Both sides thought society could be run better if things either changed or stood the same. Having a war was a step of creating a utopia, but created a dystopia at the same time, for the simple fact that it created so much chaos and violence. There were many death, even, injured men who fought for their believes. Two, El Capitan Vidal who controls Spain’s military believes that fighting, things will go your way, he believes that they will give up due to the fact the rebels do not have enough food, armor nor enough men to win the battle. However not only does he have to deal with these rebels trying to win this battle but he also has to deal with his impregnated wife Carmen along with her daughter Ofelia. Ofelia being a young child with such a big imagination notices the domination that her new â€Å"stepdad† has towards her mom and she cannot do anything but obey. As the movie progresses, you could imagine how Ofelia dos not feel the love from her mother due to a delicate pregnancy and her stepdad that cannot stand her at all. There is no utopia here but a dystopia in Ofelia’s world and it is understandable in her eyes to realize that she lives in tough times but need the care and love from both adults. Every child desires to love and to be loved back, you don’t want to feel as if people don’t care nor bother to appreciate you for the smallest things, but for Ofelia is different. Because of the lack of care she receives in the real world, she relies on her fairytale stories not to just comfort her but to let he explore the magical place in which she wants to go and call home. Since the Captain is more eager and cares more about changing Spain he forgets his family and puts them to the side. As the movie almost gets to the end, the Captain seemed to start losing control of what he had once had control of. Though he showed strength and devotion towards his country many of â€Å"his† people were spy’s for the rebel and worked for him. At the end of the movie, El Capitan Vidal is surrounded by the rebellions after killing Ofelia inside the labyrinth and he now realizes his troops and himself were defenseless and rounded up. After trying to make all these changes to Spain and putting so much effort in trying to defeat the rebellions, his idea of perfection collapses in a matter of minutes To create a utopia you must obey and never question nor answer back. According to Genesis three, God created man and woman already who he called Adam and Eve. These two first humans were in the Garden of Eden and God had clearly told them â€Å"You shall not eat of every tree of the garden? † So they obeyed and did what God told them what to do. Adam and Eve were just humans who thought everything was roses and ponies, their world was perfect; no harm, they ruled the earth. God to them was someone to look up too so they did what he told them to do. However, everything changed when one of the animals God created deceived Eve to eat an apple from the Garden of Eve. At the end she ate this apple and convinced Adam to eat; all of a sudden both gain so much knowledge and realize there both nude. They knew they disobeyed God, they knew that something was going to happen and it actually did. God punished both Adam and Eve severely and it’s obvious that God reprimanded both for not obeying, God obviously started setting rules and he didn’t like the simple fact they didn’t go by one rule he expected them to follow. A place where everything was supposed to be unlimited to both became a nightmare when both went against God’s will. Nothing turned out to be perfect. Deciding to live in the woods and leave everything back is very hard to do, but it can be done. In the section of Walden, Thoreau decides to live in the woods because he has realized that he has not lived his life. Most people would think that he is insane for wanting to live in the woods and leave everything behind him just to explore Mother Nature. People would love to live in rural areas, but Thoreau decides that he will want to live here because it is a choice he made. Usually society would think this is wrong, just because it’s thought to be game but then Thoreau seems like he doesn’t care and wants to be able to explore. That is why he is telling the reader the reason why he is doing this. In conclusion trying to reach utopia means doing so much that can lead to destruction, even lives destroyed. To reach perfection is like reaching something impossible, and when you try to reach hard there rare chances of getting to it or reaching it. Chaos and an imperfection society is what we live in now, and no one has a full vision of what a utopia should be. Different mentalities, different livings, its hard as a society even a nation to decide what’s right and wrong.

Exam the Writing Process, Part 2

Exam #00711800 The Writing Process, Part 2 1. Write a composition using one of the topics listed below. Your composition should be three to five paragraphs long. It should contain an introduction, a body, and a conclusion. Today I am writing to analyze the best way to prepare a meal. As a stay at home mom with two children me preparation is very important so as to have the meal ready on time and tasting good. I will be analyzing one of my kids favorite meals which is fried chicken and macaroni and cheese When preparing this meal I like to make sure that I have all the ingredients needed for this.Of course you will need fresh chicken drumsticks that I normally set out the morning of to ensure they are fully thawed out. You will also need 3 to 4 eggs, and cereal bowl filled half way with flour. Now for the macaroni and cheese you will need one box of pasta either elbow or shells. Those are the pasta that I choose to use but you can use any kind that you would like. You also need Velvee ta cheese and a stick of butter. To prepare the fried chicken I turn on my deep fryer and set it at 375 degrees. Next I take an empty bowl and crack open 3 eggs into it and use a fork whisk the eggs together.Then I take the drumsticks and dip them into the egg ensuring to fully coat the chicken. On full coated I roll the chicken in the flour fully coating it. Then I place the drumstick in to the fryer basket and repeat till I have at least 3 tree drumsticks to fry at one time. One I have what need in the basket I lower the basking into the heated cooking oil. I normally cook the drumsticks about 15 minutes a batch. I repeat all this until I cook the desired mount of chicken I need to feed my family which is about 6 to 8 drumsticks.Now to prepare the macaroni and cheese, you need to get out a medium size pot and fill 3 quarters full of water and place it on the stove and bring it to a boil. Once the water is at a full boil meaning the water is fully bubbling you add your pasta. Be su re to stir the pasta occasionally to make sure that the pasta is not sticking to the pot. After about 10 minutes of boiling take your spoon and check the pasta making sure they are soft enough to you taste be careful they will be hot if they’re not soft enough keep the boiling for 5 more minutes.While you’re waiting on your past grab your strainer and place it in the sink. Once you pasta is cooked take you pot from the heat and pour your contents into the strainer to get rid of the water. Next return you pasta to the pot add the sick of butter and 3 quarters of the stick of Velveeta cheese make sure you cut the cheese up into 1 inch squares. Stir all of the cheese and butter in until it’s all melted. That is how I prepare a simple yet satisfying meal for my family that takes roughly 45 minutes to prepare.Cooking meals like this saves money compared to going to restaurants all the time. I spend 15 dollars to make this rather than 25 to feed my family at McDonalds . If you’re either the cooker or the eater you get satisfaction by seeing your family enjoy the meal you prepared or enjoying the meal your loved one prepared. 2. Write a letter of complaint. Follow the rules for a business letter, and use the full-block style. Brandy Clay 1448A Alaska Ave Fort Campbell, Ky 42223 March 02, 2013 Customer Service The Salute Uniforms LLC 2724 Dorr Avenue Fairfax, Va, 22031Dear Sir or Madam: I have recently ordered a combat service identification badge for my husband from your website on February 22. I received the badge on March 1. As soon as I received the package it was noticed that the packaging had taken a beating while traveling through the mail. As soon as I opened the packaging it was apparent that the badge inside was damaged as well. When examined closer I discovered that the badge had snapped in two and the pins that are used to secure it to the uniform are bent in ways that they are not functional.I cannot find your return or exchange policy on your website. My order number is 637130. To resolve this problem, I would simply like an exchange of this combat service identification badge for another of same brand and model. I have ordered from you several times in the past and have had no issues with the merchandise or shipping. I understand that such problems as this sometimes occur with shipping. I look forward to hearing from you concerning the exchange. You can me at (830) 688-2396 or [email  protected] com. Sincerely, Brandy K. Clay

God's Existence and Essence Philosophical Theory Essay

God's Existence and Essence Philosophical Theory - Essay Example It was during this time that Aristotle’s teachings were common. He used these teachings in his own theological work although Aristotle’s teachings were really at the neck of the Christians during his reign. The intent of this paper is to discuss issues that reveal through Thomas Aquinas’ way of thinking on the existence of God. Ideas According to Thomas Aquinas came up with five ways that prove the existence of God. Then, in his first away he observed that some of the things found on earth are in constant motion. It is from his point of view that anything that is moving is likely to get started by another item, which was also in motion (Aquinas, 2006). The other item in motion was also exposed to motion by another moving item then the process continues in the same manner. The series of moving objects cannot go back to infinity to indentifying the first mover. It is true that there was a first mover of the objects that are in motion though the mover is unknown. Th is gives an impression that there is a mover who does not move. In this context, the unmoved mover is God. In the second way, he states that everything has a cause and nothing can cause be a cause of itself. In this context, the causes go back to infinity since all causes depend on the past cause and the eventual cause depended on the previous cause leading to an infinitive cause. This means that the first cause is unidentified (Aquinas, 2006). The absentee of the first cause cannot end with our scrutiny. Therefore, there must be a first cause of all these events, in which all people refer to as God. The third way to identify that there are things in nature that we observe to be possible and others are impossible as they come to exist and pass away from existence. In this context, nothing that could not exist at one point can exist. It requires that, first something exists before it can find itself existing at another moment (Aquinas, 2006). Form this statement, if there was nothing that existed in the first place, then there could be nothing existing at this time in the world. Since an effect has its cause and the subsequent cause goes to infinitive without indentifying the cause it is possible that something existed first to cause the other to exist. The unidentified cause of events in this context is the Almighty God. It is true that God existed first then caused other things on earth to exist. The fourth states that the world has characteristics that vary in degree. Some of the characteristics are more or less true, good, noble and many more examples. The grading of these characteristics is done in relation to maximum. This indicates that there should be something truest, noblest and best. According to Aristotle, there are some things, which are supreme in truth. In his view, something causes supreme truth in these characteristics and any perfection that we get in every beings of the world. He refers to this supreme cause as God. Aquinas observes nonintell igent and inanimate objects in nature that act in the direction of achieving the best probable purpose although the objects themselves would lack awareness of doing so (Aquinas, 2006). It is possible that the objects achieve their purpose though an organized a plan. The objects that are nonitelignt

Conflict within Nursing Work Environment Essay Example | Topics and Well Written Essays - 2000 words

Conflict within Nursing Work Environment - Essay Example Nurses are assuming a significant position in this system and its complex transitions. Therefore, as expected, nurses regularly experience conflicts during the course of their work, whether it is during their day-to-day practice or due to larger organizational conflicts. Interpersonal conflicts occur between individuals in the work environment. If two stakeholders are on an equivalent power level, interpersonal disagreements may simply cause irritation and annoyance. However, if one of the stakeholders has some actual or perceived authority over the other, this situation can potentially lead to what is called as conflict (Caplan G., 1964). This work is a critical reflection of a conflict event in work place that I had experienced. Before going into analysis of that particular event, the process of a conflict and its results needed to be known, since the idea of this reflective article is to explore how a conflict can be managed in practice and why. The incidence that I am going to state involves workplace interpersonal conflict, and this took place in our ward. A female senior nurse found an elderly female patient very upset, complaining about a male physician who had treated the patient in a rude manner. The patient asked for more medicine for her pain, but did not get it, and was told to accept the pain and stop nagging. The patient started to cry, but the physician let the room ignoring that she was hurt with his comments and her pain was real. The nurse confronted the physician about his conduct, and the physician began by trivializing the incident and continued by indicating his disagreement with the underlying o rganizational policy, and ended with a personal attack on the behaviour of the nurse to a physician. The stake holders in this scenario are the nurse, the physician, and the patient. It is obvious from the above scenario that there has been incompatible preference ordering between the nurse, the physician, and the patient. This is a situation where the patient has perceived that the physician has frustrated her concern. This is a destructive conflict, since this issue has been amplified, broadly defined with the addition of tangential items, and emotionally charged. When it comes to the nurse and she tries to manage the conflict, it becomes constructive when she confronts the physician to solve the issue between the patient and the physician. Here the same issue is focused and kept at a manageable size. Only peripheral issues that relate to the main point are discussed, and the process of choice is action, rather than a reaction. In contrast to destructive conflict, here when the nurse plans to resolve it, there is no competition and demonstration of power that is constructive. Her discussion with the physician about this issue is characterized by solutions that respond to the needs of all stakeholders in this conflict in an attempt to finding an acceptable solution that may be a compromise or a new one

Environmental management and quality system Essay

Environmental management and quality system - Essay Example Some such efforts towards environmental protection made by the company are high quality insulation throughout the company premises, de-stratification fans that helps re-circulate high level warm air and aluminum framed double glazed window units. In addition, the company has recycling stations throughout the company premises. This helps them recycle nearly five tonnes of plastic every year. As a result of these steps, the company has reduced the amount of waste it sends to landfill sites by 53% between 2006 and 2007. The recycling projects recycle cardboard, plastic cups, paper, metal, wood and plastics (Press Exposure). The company has its own environmental policy that states that the company will try to meet and exceed the various environmental protection legislations by introducing minimisation, reuse, and recycling. For its excellent environmental management system, the company has won ISO14001:2004 certification. Also, following the Waste Electrical and Electronic Equipment Directive guidelines, the company makes a contribution to the Product Recycling Fund. Thus, the environmental protection measures by Slingsby include making its manufacturing, warehousing and distributing centers effective through repairs and energy efficient systems, and improving office environment through the installation of ECA approved products. Also, there is waste management system that considerably reduces the disposal of wastes at landfill sites. In order to see that these measures are properly taken, there are meter reading, invoices, and other internal and external measures. A look into the concept of Quality Management proves that the purpose is to consistently meet or exceed customer requirements through management practices which will result in long term success through customer satisfaction. The company has already won ISO9001 that is the result of improvement of indirect operation by standardization. Admittedly, quality

Linguistics Essay Example | Topics and Well Written Essays - 1250 words

Linguistics - Essay Example Single BMCC student. 4) Jun-ho (Male, 28) – Single City college student 5) Jun-gil (Male, 28) – Married. LaGuardia Student, part time worker at a bar, 6) Hye-jung (Female, 27) – Single Culinary school student Throughout our conversation, we spent most of the time talking about work and family, but also about language. This made sense since we were all Koreans and often had to use English. Also, work and family are two of the most important things for all of us. If we attentively listen to the transcription, Choong-hoon spoke the most. His co-worker, Jun-gil, also spoke often. The reason for such might be because Choong-hoon is the eldest among the men in the party. Although everyone made fun of Jun-gil for only speaking to Choong-hoon, he actually spoke a lot as well. Besides, he probably talks to Choong-hoon a lot since he is just a guest who does not know everybody yet. So, we all wanted to know more about him to help him relax a bit. On the other hand, Hye-jun g, who is the youngest among the women at the party, spoke the least. It might have been because people often made fun of her Korean pronunciation. Since then, she kept quiet for quite a while. In addition, if we listen carefully at the transcription, then it becomes evident that there are some patterns. For instance, people were all polite to Jun-gil, who was not a member of the group before. So they asked him polite questions about his family and job. Between most of the other people, the style of the discussion was a lot more different. Conversations were often filled with jokes, for people were more familiar with each other. Even if this was the case, the polite conversation markers like oh-bba, were sometimes used. Interestingly, they often seemed to be used to making jokes, for they weren’t taken personally. Furthermore, there were some rules for how to interrupt or disagree with someone. Disagreement or interruption usually goes along with the gender of the people pres ent. For instance when, Hye-jung did not speak clearly, another girl said something about it first. Choong-hoon then did say he thought so too, but he did not say it so straight forward as compared to the girl’s comment. Also when Jun-gil was talking about whether he was working during his wife's labor, Jun-ho, another male, is the one who interrupts him. However, there were no fixed rules for bringing up a new topic. It was just done when we had all finished talking about something, but the most notable feature was that Choong-hoon and Jung-yeon, the eldest among the men and women in the party, usually brought up the new topic. Given the aforementioned scenario, let’s take a look at the linguistic principles and concepts in the discourse. First, we’ve learned the various properties of human language in class, and one of them is cultural transmission. Languages are influenced in by their culture; hence these languages are not so easy to understand without a suff icient cultural background. In the discourse, we used the words oh-bba, hyeong and nu-na, because in Korean, unlike in English, there are different ways of saying things like â€Å"you†, depending on how people are related socially, such as the age gaps of people. There are even different verbs for extremely polite situations. In our conversation, Jung-yeon said to Jun-gil, â€Å"It’s really difficult to speak to you in an informal way, even though you are younger than me.† That’s because it was the first time Jun-gil and Jung-yeon met, so

Historical Museum Marketing Plan Assignment Example | Topics and Well Written Essays - 4000 words

Historical Museum Marketing Plan - Assignment Example This plan includes the following sections: Analysis, where both an information audit and marketing audit inform the mission statement; Planning, where the key issues and market position applicable to the company are compiled into a strategic development structure; Implementation, where the aforementioned analysis is distilled into specific recommendations regarding product, placement, price, and promotion; and Control, where specific systems for monitoring and evaluation are framed within the context of the relevant organizational implications in terms of budget, staffing, and organizational structure. Appropriate use of the recommendations included herein will position the management of LEHM to guide the marketing of the company's products and services so as to maximize operational revenue, profitability, and funding of future growth. To assist with analyzing the company's market potential, I will perform an information audit designed to determine what needed information is lacking. I will perform a marketing audit to determine how well any current marketing resources are being used and then formulate a mission statement that management can use to help make employee's investment in the company's objectives undemanding. An information audit will provide me with the necessary parameters for developing the plan. Management has supplied me with extensive operational and historical data of good quality. There is sufficient information to understand the operations of the company, the environment in which it functions, and some of the organizational objectives it seeks to attain. Unfortunately, there is scant information in terms of marketing. The organization does not have a formal marketing strategy. Accordingly, the supplied information is helpful for general awareness but useless in terms of marketing. Complicating the process, the company does not have any procedures in place for collecting information relative to its market. As set forth in the information plan below, management will need to focus on obtaining several key elements before a successful marketing plan can be put in place. Specifically, we need several sets of data: Demographic, Competitive, Political, Economic, Socio-cultural, and Tec hnological. This information will allow the formation of an effective plan. Management should attain the necessary information by accepting the following objectives and implementing the specific procedures recommended. The information plan is charted, rated, and explained below: Information Requirements Information Availability Predicted Accuracy Timeframe to Complete Methodology Demographic Good Empirical Immediate Create Data Card Competitive Good High Immediate On-site Visitation Collect demographic data. As soon as practicable, management should utilize a simple data card to determine specific data on who is using the museum so that they can know their customers and identify any major market segments that could be targeted for marketing, i.e., their place in the market. This can be achieved by having visitors fill out a registration form upon entry to the museum, and staff completing the same form for school

Emotional intellegince Research Paper Example | Topics and Well Written Essays - 750 words

Emotional intellegince - Research Paper Example Human capital plays pivotal role in business organizations and in their success. In today’s fiercely competitive business contexts, human capital and effectively managing this high-valued resource have become major corporate strategies that affect competitive advantage (Hall, 2008). Human capital is the sum total of knowledge, skills, talents, experience, wisdom and other personal as well as professional qualities that people in the organization possess and utilize for the organization’s purposes. HR roles and functions have been evolving tremendous changes from being fundamentally administrative to making strategic decisions regarding choosing right talents for right tasks. Jarrel (2012) emphasized that focusing on the emotional intelligence of people in the organization has become another change that the HR field has witnessed very recently. It was because those employees who showed high emotional intelligence have influenced others around them positively rather than negatively. Why emotional intelligence matters in the workplace is because the way people affect others in the same workplace is an important matter to affect the effectiveness of leadership, teamwork, collaboration, knowledge sharing, organizational learning and so on. For instance, transformational or charismatic leaders are those who influence their subordinates by identifying their needs and taking positive ways to meet their requirements. Stough, Saklofske and Parker (2009) are of the view that leadership effectiveness is closely linked to the levels of emotional intelligence of the leader. With a view to achieve highest level of emotional intelligence in the workplace, human resource management adopts selective hiring and training and development program to ensure that their workforce would demonstrate EI competencies. By using Hendrie Weisinger’s Emotional Intelligence assessment tool, I found that my overall EI level was above the average, with a point of 84. The levels of self

The Bullwhip Effect Assignment Example | Topics and Well Written Essays - 1500 words

The Bullwhip Effect - Assignment Example The Bullwhip Effect is of great concern because it can lead to low profits, increased costs, poor use of transport and storage facilities, inefficiency in the use of limited resources and even crisis in placing orders. All these reasons explain why this is a great area of interest (Bhattacharya & Bandyopadhyay, 2011). It is also a significant area that should be studied in order to increase efficiency in how enterprises carry their day to day activities. I am also interested in this topic because I would like to contribute to its solution. Moreover, an aspect of academic curiosity sparked my interest in the topic. The research conducted shows a number of similarities with what I learned in the Module. For instance, the definition of the Bullwhip Effect tends to be the same. Even the environment and circumstances in which it occurs is very similar. For both, the phenomenon occurs in a supply chain where there are members placing orders to each subsequent member in the upstream. In both, the fact that Bullwhip Effect results in an increased or exaggerated variability in the upstream end more than the downstream is recognized. The Bullwhip effect arises as a result of various factors. Some of the causes are rationing and shortage gaming, price fluctuations, demand forecast, updating and order batching. These causes coupled up with the manager’s decisions, most of which are rational, lead to the Bullwhip Effect. Forecasts made based on information from the member down the stream lead to amplification of demand. Dependence on these downstream pieces of information to plan for inventory ofte n misleads. As such, many upstream members end up having a greater variability of demand (Lee et al., 2014). Another cause is the frequent change in prices in the market. Sometimes the manufacturers reduce the prices of their products. This makes more suppliers in the downstream end to do ‘forward buying’. This is in a

Panera Bread Company Essay Example for Free

Panera Bread Company Essay SWOT Matrix Stakeholder Matrix Financial Ratios Financial Trend Graphs Responses to Questions Not Answered in the Presentation Business Strategy Functional Area Strategies Assessment of Panera Bread Company? s Strategic Performance Resources Value Chain Assessment of Panera Bread Company? s Financial Performance and Capabilities Strategic Issues Panera Bread Company Faces Management? s Values Organizational Culture Executive Summary: Our consulting team completed an analysis of Panera Bread Company mainly focusing on the opportunities and threats within the industry, Panera? competitive capabilities, and the company? s strengths and weaknesses. The following recommendations contain the opportunity or threat within the industry, the strength or weakness that allows Panera to pursue or defend against the critical issues and the tools needed to take immediate action. We recommend that Panera Bread Company: 1. Open cafes in untapped markets, and focus on utilizing franchising to achieve the desired 1:160,000 cafe: person ratio by 2010. We found that the restaurant industry life cycle is still in growth. This growth coupled with Panera? strong franchising capability offers a significant opportunity for Panera to pursue. To achieve this Panera must first use the current site selection and market analysis processes to chose ideal locations for new cafes in untapped markets. Panera should also utilize this process to assess the logistics necessary to support the potential locations. Next, Panera needs to utilize the established, stringent franchisee selection criteria to identify candidates that are a good fit, and then work with the selected franchisees using the existing franchise assistance programs to educate and train franchisees in Panera? unique brand, vision and culture. Once Panera sets up franchising systems in new markets, the company should measure success by whether or not the 1 cafe per 160,000 people per location by 2010. Panera also must assess the new franchisees based on the historical areas of success. 2. Bolster the current promotional strategy to a more aggressive soft-sell promotional strategy while still utilizing word-of-mouth tactics to increase first-time customer traffic. We found that customers are prone to give newly opened eating establishments a trial. Panera has underutilized potential in its promotional strategy to allow customers to know of newly opened cafes. Panera can pursue the opportunity within the industry if it strengthens the current promotional strategy to promote awareness. This helps Panera promote brand awareness to become a dominant leader in the bakery-cafe industry. To do this, the company must begin expanding to untapped and lowpenetrated markets where customers will not know much about the company. The company must then increase excitement about these new cafes before opening by using guerilla marketing. An example of this is hiring plain-clothed personnel to circulate future and current development sites and engage potential consumers by drumming up interest in cafe openings. The next implementation step is to distribute coded coupons with a two-week expiration period, and an additional coupon to be given to a friend. Success can be measured by tracking new customer foot traffic in the specific cafes and the new cafe? s sales volume in the first six months. 3. Implement the â€Å"Oven Fresh, To Go† program that will increase customers switching costs and reward buyer loyalty through progressive discounts based on levels of return patronage. Our analysis revealed that the restaurant industry is threatened by low switching costs and low customer loyalty. Our analysis revealed that Panera had strengths in buyer loyalty. Panera should first begin steps one month prior to the start of this service using signage and promotion. Next Panera should print menus that displaying the oven fresh option and distribute them at the point of sale. Panera should cross train employees on the oven fresh operational procedures of taking orders and bringing orders to customer? cars. Next Panera should purchase or lease 2 to 3 parking spots per location in close proximity to the door with signs for designated parking. Last Panera should place a pre-paid post card with survey questions inside to-go packaging and place customer loyalty punch card in packaging that rewards returning loyal customers. Panera should track the discounts given by customers. Because of the progressive nature of the discounts, Panera can identify its most loyal clientel e based on the level of the discount rate. 4. Broaden the product scope and service offering to include a wider array of light entrees, dinner fare, and beer and wine available after 4:30 at select locations nationwide. The new offerings will be paired with community events such as wine-tastings and fundraisers to bolster the perceived dinner atmosphere. Our analysis of the restaurant industry led us to determine that there were a large number of buyers available to firms providing an opportunity for increased market share. Our analysis of the competitive capabilities showed that Panera had an internal strength in research and development. Panera needs to utilize the extensive research and development skills to determine ideal menu offerings, portions, price, and locations suitable for beer and wine. The new product offerings will be introduced to a limited number of stores to determine customer response and verify the scalability to ensure quality. The successful food and alcohol items will be introduced to pre-determined ideal locations along with marketing and training support. The final implementation step will be a market survey question at the point-ofsales system that will determine the number of new dinner customers. The ultimate goal of this recommendation is to increase market share for Panera. Macro-Environment: The United States saw 3. 0% growth in the overall economy for the year 2006. Additionally, real disposable income increased by 2. 1% from the third quarter of 2005 until the end of 2006. The unemployment rate continued on a downward trend from a high of 6. 0% in 2003. Unemployment was 4. 65% in 2006. According to the Bureau of Labor Statistics, consumer expenditures were $48,398 and $2,794 was spent on food away from home per household. Because there was overall economic growth, consumer expenditures ere high, and unemployment was on a downward trend, the economy at large was in a healthy state. When economic conditions were perceived as good, consumers were more willing to spend excess income, as opposed to saving or investing. Therefore, consumers were more likely to spend money on eating out for various meals; this was an opportunity for the restaurant industry. The legal, regulator y and political environment was relatively stable in 2006. Because there was a stable regulatory and political environment, business owners were able to operate at a more functional level. Companies were not worried about significant changes to regulations which hinder business growth. Therefore, this stable environment was an opportunity for the industry. The population demographics for the U. S. consumer in 2006 were as follows. The population was 49. 27% male and 50. 37% female; the median age was 36. 4. About 15. 07% of the population was over 62 years old. The median income was $46,326 for a single earner household and $67,348 for a dual earner household. Of the total 299,398,484 consumers, 36. 43% lived in the South Region, 18. 8% in the Northeast Region, 22. 12% in the Midwest Region and 23. 16% lived in the West Region. In the U. S. 31. 7% of persons over the age of 25 were a high school graduate; 18. 3% held a Bachelor? s degree, and 9. 7% held an advanced degree. Because of the large number of variables and the diversity of the U. S. population across all descriptors, the restaurants industry? s target market was large and the individual buyers were small and numerous. This caused decreased competition over potential buyers, and therefore was an opportunity in the restaurant industry. There were two significant societal trends that emerged among restaurant industry stakeholders in 2006. First, the issues surrounding trans-fats in restaurants were coming to a head after a 2003 court case. Consumers called for a ban on trans-fats in restaurant food in many different states. Since this made restaurants appear to be the culprit, it decreased customer satisfaction with local restaurant establishments. This decrease was a treat to the industry. Second, the baby boomer generation was aging, and the children of the baby boomers were moving out. This increased the number of empty nesters in the U. S. With no children at home and both husband and wife working, the couple was less likely to arrive home and feel the need to cook dinner. This phenomenon led to more dinner outings and consumers looking for an establishment to eat a quick and quality meal. Because this increased the numbers of consumers looking to dine out, the aging baby boomer population increased the number of meal occasions and therefore was an opportunity for the industry. Industry Analysis: i. Industry Drivers: The market size of the industry was quite large. Commercial eating places accounted for about $345 billion†¦ The U. S. restaurant industry †¦ served about 70 billion meals and snack occasions, and was growing about 5 % annually. † Based on unit sales of $345 billion, sales volume of 70 billion and a growth rate of 5 % annually, we conclude that the market size of the restaurant industry was quite large and growing. Because when the mar ket size of the competing industry was growing, rivalry among competitors decreased, we conclude that decreased rivalry was a threat for the restaurant industry. The scope of the competitive rivalry was broad. Restaurant chains competed on regional, national and global levels. The product scope was also broad. The industry served breakfast, lunch, dinner and snack covering many ethnic tastes. Because geographic and product scope were wide, industry members competed in many geographic areas and over a wide array of product lines. Because competition was increased, we conclude that the scope of competitive rivalry was a threat for the industry. Market growth rate and position in the business cycle was in the growth stage. The U. S. restaurant industry†¦ served about 70 billion meals and snack occasions, and was growing about 5 % annually. † Because the industry was growing at a rate of 5 % annually we conclude that the industry was still in the growth stage. Because no indication was given that growth rate was declining, we conclude that the rate was not increasing at a decreased rate and therefore not approaching maturity. Because e xpanding buyer demand produced enough new business for all industry members to grow without using volume-boosting sales tactics to draw customers away rom rival enterprises, rivalry in the industry was decreased when the life cycle was in growth. Because rivalry decreased when the industry was in growth, we conclude that the growth rate was an opportunity for the industry. The number of buyers and their relative size in 2006 were as follows. â€Å"On a typical day, about 130 million U. S. consumers were food service patrons at an eating establishment – sales at commercial eating places averaged close to $1 billion daily. † Since 130 million consumers spent $1 billion daily, we conclude that on average, each consumer spent $7. 9 per day. Based on our analysis, we conclude that the number of buyers was large and their relative size was small. Because buyers have more power when they are large and few in number, we conclude that many small buyers was an opportunity for th e industry. The pace of technological innovation in product introduction was fast. â€Å"Most restaurants were quick to adapt their menu offerings to changing consumer tastes and eating preferences, frequently featuring heart-healthy, vegetarian, organic, low-calorie, and/or low-carb items on their menus. It was the norm at many restaurants to rotate some menu selections seasonally and to periodically introduce creative dishes in an effort to keep regular patrons coming back, attract more patrons, and remain competitive. † The constant change in consumer tastes and habits and the rate at which most competitors stayed on top of the changes made product competition very fierce. To stay competitive, establishments needed similar commitment to constant revision of menu items. We conclude that the fast pace of innovation in product introduction was a threat for the industry. Product differentiation in the industry was common. Industry members pursued differentiation strategies of one variety or another, seeking to set themselves apart from rivals via pricing, food quality, menu theme, signature menu selections, dining ambiance and atmosphere, service, convenience, and location. † Despite attempts to differentiate products, the restaurant industry operated in a pure competition environment where switching costs were low and there were many competitors. Because the industry products by nature were weakly differentiated, we conclude that the extent to which rivals differentiate their products was a threat to the industry. The learning and experience curve for the restaurant industry was low. â€Å"Just over 7 out of 10 eating and drinking places in the United States were independent single-unit establishments with fewer than 20 employees. † Because 70 % of competitors were restaurants who could open and close at any time, new entrants did not need large corporate backing and were free to open anywhere. The ability of so many small competitors to enter and compete in the industry indicated a steep learning curve. The steep learning curve and low capital requirement was threat to the industry because of the ease of rivals to enter the industry. i. Five Forces: Our analysis revealed that there were about 624,511 commercial eating locations in the industry. Because rivalry intensifies as the numbers of competitors increase and as competitors become more equal in size and competitive strength, we conclude that the high number of competitors was a threat for the industry. Based on industry sales of $ 345 billion, the leading competitor Starbucks had less than two percent of the market share. This fact coupled with the above mentioned 70% single unit establishments characterized the industry as having many competitors with very small market share. Because rivalry tends to be stronger when competitors are numerous or are of roughly equal size and in competitive strength, we conclude that the small relative size based on market share was a threat for the industry. Switching costs and buyer loyalty were low for the industry. â€Å"Consumers (especially those who ate out often) were prone to give newly opened eating establishments a trial†¦loyalty to existing restaurants was low when consumers perceived there were better dining alternatives. Because low switching costs and low buyer loyalty increase rivalry among competitors, we conclude that low switching costs and buyer loyalty were a threat to the industry. It was not more costly to exit the industry than continue to participate. â€Å"Many restaurants had fairly short lives. † Based on our previous analysis of market share, we determined competitors were small in size and can enter and exit with little capital requirements. Assets were sold easily and the workers in the industry were not entitled to significant job protection. Because rivals had low barriers to exit they did not resort to deep discounts to remain in business. Continuous new entrants increased rivalry. We conclude that the ease of entry was a threat and ease of exit was an opportunity for the industry. The industrys products were discretionary purchases. â€Å"The average U. S. consumer ate 76% of meals at home. † The fact that consumers could eat at home for less characterized the discretionary nature of the eating out option. Because discretionary spending was not necessary and represent consumers? first costs to cut in economic difficulty, we conclude that the discretionary nature of the purchase was a threat to the industry. iii. Changes to the Industry Structure and Competitive Environment: As of 2006, the restaurant industry was growing by 5% a year. Due to this growth rate there was room for more firms to enter the industry. This changed the industry structure in the coming years by introducing more competitors. However, since the market was not saturated, firms entering were in a business environment that allowed them to obtain new market share. Since the long-term growth rate was increasing there was an opportunity for new firms to gain the growing market share. The average U. S. consumer ate 76% of their meals at home. The average person in 2004 had $974 of income to spend on food purchases away from home. Customers were less likely to be loyal to a restaurant if they perceived a better option available to them. Patrons also used restaurants for more than just eating. Restaurants served as places where people could catch up on work, meet friends, and read the paper. The fact that majority of meals were eaten in the home and that restaurant spending was discretionary, coupled with the fickle and specific nature of the customer created strong competition among rivals, and resulted in a threat to firms. Marketing innovation in product and promotion was especially strong in the restaurant industry. Firms constantly updated their menus to accommodate new trends such as low calorie, organic, vegetarian, and heart healthy foods. Restaurants also utilized Wi-Fi and large television screens in order to enhance the experience for customers. Happy hours and other events served as promotion to attract new customers. The constant marketing pressures created complex rivalries between firms and resulted in an altered industry structure. The industry structure resulted in a business environment where firms diligently adapted and changed with updated marketing mixes. This constant change was a threat within the industry. Entry into the restaurant industry was marked by just over 7 of 10 eating and drinking places being independent, single-unit establishments with fewer than 20 employees. Exit from the industry was frequent and often firms were limited to short lives. The easy entry and exit of firms to and from the industry created a business environment that was fiercely competitive. The ease of new rivals entering and the large failure rate was a threat for firms within the industry. iv. Existing Rivals Competitive Capabilities Analysis: The case did not provide specific information about rivals? resources and strategic goals to formulate conclusive competitive capabilities. v. Key Success Factors: The key success factors in the restaurant industry were dictated by what consumers deemed necessary attributes to have and what allowed the business to profit. Consumers did not dine at particular places that did not possess these qualities because they lost value in their purchase. Also, there were many substitutes that offered the key factors to patrons instead. The particular key success factors related to the restaurant industry were: low-cost production efficiency, customer service, breadth of product line and selection, ability to respond quickly to shifting market conditions, overall consumer experience, image and reputation, and high consumer volume. The first key success factor was low-cost production efficiency, which was crucial in lowering prices for the consumer. When a restaurant could not keep costs low, the high costs were passed through to the consumer with a higher price. If customers did not believe the value in what they were buying was worth that high price, they did not pay for it. Since there were many competitors in the restaurant industry, the consumer shopped around for similar food at a lower price. Restaurants needed to keep these costs low to stay competitive and not risk bankruptcy. Customer service was another key success factor because it added value to the meal. The consumer was not just purchasing food; they were paying for the entire experience. A component of this was having pleasant employees in all customer contact positions. Good customer service skills that made the customer feel comfortable in the restaurant helped to keep customers coming back. When a waitress went above and beyond her normal duties to please a customer, the patron was likely to return because of the great experience offered. Exceeding customer expectations was crucial in attracting loyal customers who returned to the establishment. Another factor for success was having a wide breadth of product line and selection. Restaurants needed to offer many different kinds of dishes to attract a broad group of buyers. Some examples were serving chicken, beef, seafood, and vegetarian. If there were ten dishes or so within each of those categories, the restaurant was offering a large selection and a customer could find a meal they craved. Offering various types of dishes helped widen the breadth of what was offered, such as: breakfast, lunch, dinner, soups, salads, pasta, and sides. There were also various styles of food offered such as Mexican, bland, Cajun, Irish, Italian, Mediterranean, and more. Such a broad selection ensured that customers found what they were looking for. If the consumer saw multiple meals he or she as interested in, he or she returned. The fourth key success factor within the restaurant industry was the ability to respond quickly to shifting market conditions. Customers were constantly changing what they wanted, and restaurants needed to keep up with those changes. If a restaurant had an inability to change its menu, it could not compete with its rivals. Recently, consumers changed their needs to heart healthy, vegetarian, organic, low calorie, and low-carb. This also took into consideration seasonal changes. Soups became more prevalent in the winter than the summer. Certain seasonal soups like pumpkin, squash, and others were craved around the holidays, but not as much during other times in the year. Desserts and specialty beverages followed similar patterns. Restaurants needed to change their menus to satisfy customers? cravings and remain competitive within the industry. Having a good overall consumer experience was extremely important in the restaurant industry. This was crucial in building a loyal clientele that could promote the business through word-of-mouth tactics and regularly dined at the establishment. The overall experience took into consideration more than just food and customer service because it encompassed the entire value perceived by the consumer. This included price, food quality, quality of service, ambience and atmosphere, and having a variety of offerings. Without that great experience, a customer would not return and they could verbally damage the restaurant? s reputation when they told friends about their poor experience. This factor was important to build loyal customers and increase brand awareness. Image and reputation was another key success factor because this was what attracted customers to the establishment. This also created word-of-mouth advertising for a restaurant. When something happened to tarnish a restaurant? s reputation, patrons no longer dined there, which led the company to go out of business. Image and reputation was how consumers perceived the company, which could add value for the customer when it was extremely good. Another key success factor was having high consumer volume. No matter what type of eating establishment, having high customer foot traffic was essential for success. This increased brand recognition, word-of-mouth advertising, and sales. This factor was essential to success in the industry, without it, a restaurant was unable to grow, or even survive. These seven key success factors dictated the industry and how restaurants needed perform in order to remain competitive in the industry. The restaurant industry was purely competitive and extremely risky due to the large number of rivals. The seven factors were areas to focus on because that was what consumers deemed important. Critical Issues the Industry Faces: Our analysis led us to the following critical issues faced by the restaurant industry. There were many opportunities in the industry for businesses to capitalize on. According to the analysis of the industry drivers, we concluded that the business life cycle was still in growth and there was a capacity shortage in the industry. This was an opportunity for the industry. Based on our analysis of the five forces model, we concluded that there were many buyers in the industry with many choices in selection of products. This was also an opportunity for the industry. Based on our analysis of the industry drivers, five forces model, and the changes to the industry structure, we concluded that there were untapped markets and consumers were prone to give newly opened eating establishments a trial. Based on our analysis of the changes to the industry structure and the competitive environment and the five forces model, we concluded there was a threat to the industry in that there was low customer switching costs and low customer loyalty. Panera Bread Company’s Competitive Capabilities: i. Business Strategy: Panera Bread Company? s strategic intent was â€Å"to make Panera Bread a nationally recognized brand name and to be the dominant restaurant operator in the specialty bakery-cafe segment. † Panera intended to achieve this by â€Å"being better than the guy across the street† and implementing a successful business model. Panera? s business model satisfyed customers? needs through providing quality food in a casual setting that continued to bring customers in for the ambiance as well as the food. Panera achieved sufficient profits to cover the costs of providing this value to the customers by selling food in the cafes and by collecting franchising fees and a percentage of franchisee sales. Management intended to grow the number of Panera Bread locations by 17% annually and expand further into suburban markets. Panera focused on achieving a 1 cafe per 160,000 people per location ratio by 2010 through effective use of franchising. Panera intended to build a loyal clientele by employing a superior business model and offering artisan breads as a base of a high quality menu that changed to reflect evolving consumer tastes. The prevailing market in which Panera operated experienced 5% growth in 2006. Thus Panera? s strategy of growth was in sync with market conditions. Furthermore, by focusing on building a loyal clientele through quality breads and a menu that suits customers tastes, Panera tailored the strategy to strengths the company already possessed. Panera? ability to create well crafted, predictive strategies and adapt well to changing conditions with reactive strategies indicated that Panera? s strategy was a dynamic fit to the company and market. Therefore, Panera? s strategy was a good fit for the company. Operating in an almost pure competition environment, Panera faced threats from low cost and differentiated products. Panera employed a best cost provider strategy to take advantage of the large amount of value-conscious buyers who want a good meal and pleasant dining experience at an affordable price. Taking a position as best cost provider, in conjunction with a commitment to â€Å"providing crave-able food that people trust, served in a warm, community gathering place by associates who make guests feel comfortable† helped Panera achieve a strong strategy, but the competitive nature of the industry does not permit the strength of Panera? s strategy to become a competitive advantage. Panera had 0. 5409% market share of the $345 billion annual sales in the restaurant industry. Though Panera was not a dominant operator, this was a relatively big market share, given the nurture of the industry. The company? s profits and number of locations grew from 2002 to 2006. Panera? s strategy led to a strong financial position and a sizable market share. Because Panera? s strategy was a good fit for the company, was strong in the competitive industry, and was financially successful, we concluded that Panera? s strategy was working very well and gave the company a competitive position in the industry. Therefore we feel Panera? s overall strategy, as well as its strategy to grow the business and build a loyal clientele was a strength. ii. Functional Area Strategies: Panera? s marketing strategy contained three distinct initiatives. The first aimed to raise the quality of awareness about Panera by focusing on quality crave-able food the consumer can trust, and by enhancing the appeal of its bakery-cafes as gathering places. The second initiative focused on boosting awareness and trials of Panera at multiple meal times. The third initiative was to increase consumers? perception of Panera as a dinner option. Throughout the entire marketing strategy Panera avoided hard-sell, in-your-face advertising. Panera preferred consumers â€Å"gently collide† with and discover the brand. As Panera performed well financially in past years, this marketing strategy was successful. However our analysis led us to conclude there was an untapped potential in the soft-sell marketing technique. This was a weakness that Panera must bolster to pursue industry opportunities. Panera? s production and distribution strategy was to use economies of scale and centralize operations for the dough making process. There were 17 regional fresh dough facilities to service the 1,027 Panera bakery-cafe locations. By controlling the process at central locations Panera was able to ensure consistent quality and dough making efficiency. Panera? s production strategy supports the overall strategic intent of being better than the guy across the street and ensures quality to keep customers coming back. Because Panera? s production strategy supported the company? s overarching strategic goals, we concluded that the strategy was working well and was a strength for Panera. Panera had a unique franchise system. Each franchise license was for a multi unit deal, usually for 15 bakery-cafes to be opened over six years. Panera only granted licenses to applicants who met stringent criteria. These criteria included a net worth of $7. 5 million or more, access to resources that would allow for the expansion of 15 locations, real estate and multi unit restaurant operator experience and commitment to Panera? s brand, culture and passion. Historically, Panera? s ambitious franchising model was a success. Franchisees indicated a high level of satisfaction with Panera Bread Company? s concept, support and leadership. Likewise, Panera reported satisfaction with the quality and pace of franchisee openings and the franchisees? perations. Panera committed limited fiscal resources to franchising; the company did not â€Å"finance franchisee construction of area development payment, or hold any equity in any of the franchise-operated bakery-cafes. † Because the franchising model supported the company? s intent to grow to a dominant restaurant operator, we concluded Panera? s franchising system was a streng th. Panera committed to constantly staying in tune with consumers? changing tastes for the base of the research and development strategy. Panera regularly reviewed the menu and revised the options to sustain customer interest. When developing new products, Panera first made the menu items in test kitchens before introducing them in a select few bakery-cafes. Panera used the test kitchens and select rollouts to determine customer response and ensure that the products could be produced in mass quantities and still maintain the high quality standards associated with the Panera brand. The successful products were then introduced in all the chain locations and integrated into menus. Because it helped keep up the Panera standard for quality food that customers craved, the research and development aspect of Panera? s strategy supported the marketing strategy. Furthermore, by ensuring consistently high quality food that consumers depended on, Panera? s extensive research and development supported the company? s strategic goal of becoming a dominant operator in the restaurant industry. iii. Assessment of Panera Bread Company’s Strategic Performance: -Business Strategy Performance The strategic intent of Panera was to become a nationally recognized brand and dominant operator in the specialty bakery-cafe segment. In 2005 Panera Bread was the highest rated for the fourth year in a row among competitors in the Sandleman ; Associates national customer satisfaction survey. Panera had also won â€Å"best of† awards in 36 states and across a range of markets. In addition, â€Å"J. D. Power and Associates? 2004 restaurant satisfaction study of 55,000 customers ranked Panera Bread highest among quick-service restaurants in the Midwest and Northeast regions of the United States in all categories, which included environment, meal, service, and cost. † Panera created this nationwide renown through the successful implementation of the company? s business model. In 2006 Panera opened 155 company and franchise owned cafes bringing the total units to 1,027 in 36 states. The continued expansion of cafes in new markets showed that Panera was operating successfully within the framework of the intended strategy. However, Panera managed to open only 1 cafe per 330,000 by 2006. So, although Panera had begun the process of increased penetration into markets, the benchmark given of 1 cafe per 160,000 people in 2010 at the time of the case had not been reached. Therefore a complete analysis of the success of the growth strategy was not possible. Panera differentiated the bakery-cafes by implementing several important menu changes that addressed the targeted consumer needs and trends. The addition of â€Å"good carb† breads, antibiotic-free chicken, and an artisan line of sweet goods were employed as part of a differentiation strategy. In 2005-2006 Panera introduced the G2 concept in an attempt to bolster the dining environment, thus providing more value for the customer. There was no data to support or deny the effectiveness of these strategic moves. -Functional Area Strategic Performance Due to fact that the Panera won considerable accolades in consumer satisfaction, we determined that its marketing initiative of developing customer awareness of the quality and trust-worthiness of the company? s food was working. The second initiative of boosting awareness and trial of dining at Panera Bread at multiple meal times had not been shown operationally. Therefore, we were not able to determine the performance of this strategy. The marketing data showed that, â€Å"85 % of consumers who were aware that there was a Panera Bread bakery-cafe in their community or neighborhood had dined at Panera on at least one occasion. † From this data, we concluded that the strategy was sound to pursue and specifically implement. The third initiative of increasing consumers? perception of Panera as a dinner option had not yet been implemented with specific steps. The marketing research showed that 81% of consumers indicated a â€Å"considerable willingness† to try Panera at other meal times which supported following this strategy into the implementation phase. Panera? s production and distribution goal was to ensure lowered costs and quality control with a strategy of centralized locations taking advantage of economies of scale. The quality of the product was evidenced by the many â€Å"best of† awards and other consumer satisfaction accolades. The lowered costs due to economies of scale and the high quality of the products indicate that Panera? production and distribution strategy was successfully implemented and executed. Panera pursued a unique franchising model based on multi-unit, multi-year deals with franchisees who were selected based on stringent criteria. The franchised cafes performed better in return on equity investments and average weekly and annual sales than company-owned cafes and were also equally or slightly m ore profitable. The measured success of the franchisee owned stores showed that the franchising model strategy was performing well. The research and development strategy was to stay in tune with customers? changing tastes. The implementation consisted of regularly reviewing and revising the menus, and the use of test kitchens for exploring new products and determining customer response. In 2003 Panera scored the highest level of customer loyalty among quick-casual restaurants, according to a study conducted by TNS Intersearch. This customer loyalty indicated the success of Panera in anticipating customer needs through the company? s research and development strategy. iv. Resources: Panera had skills and expertise in sight selection and cafe environment. They chose sights and cafe environment by the following method. Based on analysis of this information, including the use of predictive modeling using proprietary software, Panera developed projections of sales and return on investment for candidate sites. † This recourse was difficult but not impossible to copy. The length of time it would last depended on how hard competitors chose to work to develop similar technology. This resource was really c ompetitively superior because no other competitors had it. It could not be trumped by rival? s resources because the same software had to be developed before competitors could use it. Because this resource was hard to copy, competitively superior, potentially long lasting and could not be trumped by rivals? resources, the site selection and cafe environment was a competitive capability. This competitive capability was a strength that gave Panera a competitive advantage. Our analysis revealed that Panera? s advertising and promotion strategy was too weak. They had underutilized promotion potential. Panera? s strategy was to raise the quality of awareness by the â€Å"caliber and appeal of its breads and baked goods, by hammering the theme â€Å"food you crave, food you can trust. Panera also aimed to â€Å"raise awareness and boost trial of dining at Panera Bread at multiple meal times (breakfast, lunch, â€Å"chill out† times, and dinner. )† Panera avoided hard-sell approaches, preferring â€Å"instead to employ a range of ways to softly drop the Panera Bread name into the midst of consumers as they moved through their lives and let them „ge ntly collide? with the brand; the idea was to let consumers „discover? Panera Bread and then convert them into loyal customers by providing a very satisfying dining experience. † This approach was a great concept and successful to an extent, however we conclude that because many of Panera? competitors were using more aggressive promotion, the current strategy was not aggressive enough. â€Å"Management claimed that the company? s fresh- dough-making capability provided a competitive advantage by ensuring consistent quality and dough-making efficiency. † Because this dough making capability allowed Panera to maximize the production capacity, used no preservatives, did not freeze the product and control the quality of the dough by making it themselves, this recourse was hard to copy. How long it would last depended on strengthening competitor capabilities and their interest in the dough making market. Based on the first two tests, we conclude that this capability was really competitively superior and could not be trumped by rivals? capabilities and therefore a competitive advantage. Panera? s franchise system used superior intellectual capital with the use experienced and capable workforce. The success of the franchise system was an example of proven managerial know-how. The site selection software granted the franchises cutting-edge knowledge in technology to choose locations and cafe environments. The stringent franchisee requirements employed only the most dedicated, well capitalized and capable franchisees as managers. The franchise system was hard to copy because of the stringent requirements for the franchisees, managerial know-how and the proprietary site selection software. Site selection system would tend to last because of how difficult it was to copy and could not be trumped by rivals because it was so rare, and was characterized by a gradual learning curve. This analysis led us to the conclusion that Panera? s franchise system was a distinct competitive capability and therefore gave Panera a competitive advantage. The product research and development program was also an example of Panera? superior intellectual capital. â€Å"Product development was focused on providing food that customers would crave and trust to be tasty. New menu items were developed in test kitchens and then introduced in a limited number of the bakery-cafes to determine customer response and verify that preparation and operating procedures resulted in product consistency and high quality standards. If successful, they were then rolled out system wide. † The research and development system was hard to copy because of the gradual learning curve and constant need for revision. Because every competitor was also engaged in tactics to improve product development, we conclude that this intellectual capital was only hard to copy in Panera? s specific product line. Because it was not generally hard to copy we do not conclude that it was competitively superior. Based on our analysis, we conclude that Panera? s product research and development was a resource capability and therefore strength, but it was not a competitive advantage because many competitors have the same resources. Panera? s financial position was an important resource. Panera had a low debt to equity ratio. In 1998 this strategy began with the sale of Au Bon Pain for 73 million in cash. This strategy was well served by the franchise system. â€Å"Panera did not finance franchisee construction or area development agreement payments or hold an equity interest in any of the franchise- operated bakery-cafes. † The franchise system allowed Panera to keep long term levels debt low. This allowed Panera to use cash reserves and or take on long term debt at lower costs when capital was necessary to seize opportunities. Panera? s financial position was a resource capability because it was hard to copy. The resource tended to last long because the franchise system kept debt low. It was not really competitively superior because other competitors could have had similar financial positions. Because this capability was hard to copy but it was not competitively superior, we conclude that it was a capability and there for strength, but not a competitive advantage because others may have a similar financial position. v. Value Chain: -Inbound Logistics The case does not provide enough information to comment on the inbound logistics that Panera has with suppliers. However, each franchisee purchased dough directly from Panera Bread. Panera had an interest in each of the franchised stores succeeding because the company received 4%-5% royalties from sales continually. This meant Panera as the supplier had an interest to keep prices of dough as low as possible to maintain viable franchise operations. -Operations Panera provided and required comprehensive front and back of house training, market analysis, and bakery-cafe certification. This corporate level tactic impacted the company? franchised and company owned stores by enabling Panera to develop systems used by all the cafes thus applying economies of scale to operations. Since each cafe-bakery did not have to develop its own operations structure this reduced costs for each store. In addition, the methods Panera introduced to each store had proven historically successful, thus increased the learning curve for a new cafe and lowered costs. Panera had a policy to not finance new franchisees, area development payment agreements, or hold any equity in the new cafes. This operational model resulted in minimal long-term debt and low capital intensity to expand the Panera brand. All the cafes offered an assortment of 20-plus varieties of bread baked daily and as of 2006 at least 22 types of sandwiches. Each of these breads and sandwiches were regularly reviewed to determine whether the products matched regular customer needs, new consumer trends, and seasonal relevance. The complexity of the product line enabled Panera to match menu items with a variety of customer needs. This process ensured that weak selling items would be removed limited excess inventory. Outbound logistics Each franchisee purchased dough directly from Panera Bread. Each dough making facility was able to produce dough for six bakeries. The fresh dough was sold to both companyowned and franchised bakery-cafes at a delivered cost not to exceed 27% of the retail value of the product. These costs margins were achieved by producing the dough at central locations employing economies o f scale. -Sales and Marketing Panera used focus groups to determine customer food and drink preferences, and price points. This work was done by only a few individuals at the corporate level and scaled to the rest of the cafes. The existing company and franchise owned cafes would be able to take advantage of this market information and reduce costs associated with sales and marketing information. The franchising model Panera used required the franchisee to pay 0. 7% of total sales to a national advertising fund and 0. 4 % of total sales as a marketing administration fee. Franchisees were also required to spend 2. 0 % of total sales on advertising in local markets. Panera contributed similar amounts of capital from the company owned stores. Requiring the franchise owned cafes to pay a significant portion of marketing costs allowed Panera Bread to lower the company? s capital contribution. -Research and Development New menu items were rolled out in limited cafes and developed in test kitchens prior to nationwide release. This process addressed two cost drivers. First, by employing economies of scale individual cafes will not have to spend resources and capital investing in the development of new menu items. Second, through the expertise of the advanced research and development department Panera ensured both quality of product and process. This resulted in less product waste and increased customer satisfaction and in turn lowered costs. -Integrated Value Chain Effect Panera Bread utilized both structural and executional cost drivers to lower costs on the value chain particularly in inbound logistics, operations, outbound logistics, sales and marketing, and research and development. The cost reduction across the value chain gave Panera a strong capability. vi. Assessment of Panera Bread Company’s Financial Performance and Capabilities: Panera Bread Company showed growth in its profitability from 2002 to 2006, but there were no industry standards presented to compare the numbers in relation to the industry and individual competitors. Panera Bread Company stated a desired growth rate of 17% each year, and the sustainable growth rates from 2003 to 2006 were all above this desired rate (See Financial Ratios Section), but the internal growth rates were slightly lower for these years (See Financial Ratios Sections). For the most part, Panera Bread Company showed consistent results for the profitability financial ratios calculated. Therefore the company maintained management? s objectives and values each year. Panera? s ability to maintain cash reserves allowed the company to expand and open new cafes while maintaining management? s goal of not taking on large amounts of long-term debt. Panera Bread Company showed increased revenues as the number of cafes increased, which shows company growth (See Financial Trend Graphs Section). Also, Panera? current ratio was 1. 16 in 2006, which shows the company was able to satisfy all current obligations from operating activities without the need for long-term financing. Since Panera strives to decrease long-term debt, the cash reserves could be used for expansion without the need to restrict assets for future obligations. The company presented low total debt and debt-toequity ratios which allowed the company to avoid overleveraging itself. This also left so me capacity for the company to take on long-term debt if deemed necessary during expansion. The company created a strong financial position for itself by having available cash reserves and diminishing the amount of long-term debt assumed. This created an opportunity for expansion. vii. Strategic Issues Panera Bread Company Faces: The strategic issues that Panera faced were as follows. Our first strategic issue was Panera? s potential to use its internal franchising capabilities to take advantage of the fact that the industry life cycle remained in its growth phase. The second strategic issue Panera faced was how to alter its existing promotion strategy in untapped markets in order to take advantage of the opportunity presented by customer? s willingness to try new restaurants. The third strategic issue was how Panera could use its internal capability to build loyal clientele to defend against the threat of low switching costs and low customer loyalty. The final strategic issue was how Panera could use its internal capability of advanced research and development skills to take advantage of the large number of buyers within the industry. iii. Management’s Values: Management valued the enthusiasm Panera Bread cafes showed for the quality and value of the products offered. The main example was in the company? s dough making capabilities. Panera believed that actions spoke louder than words, so the company needed to show the high quality of its food to the customers. Management believed that the â€Å"attractive menu and the dining ambience of its bakery-cafes provided significant growth opportunity, despite the fiercely competitive nature of the restaurant industry†. Management strived to become the dominant operator within the bakery-cafe segment as well as a leader in the specialty bread segment while making its brand name nationally recognized. Another key value within Panera? s management was maintaining a debt-free balance sheet. The ability to uphold this value came from the company? s franchising model because the franchisees financed the majority of the cafe building expenses. Management stressed the quality of the food and service offered and knew that all other goals, such as expansion, recognition, and holding a higher market share, would simply fall into place as a result. x. Organizational Culture: Panera Bread Company? s organizational culture began with the overall company and the dough-making facilities and spread out to the bakery cafes, whether company owned or franchised. Panera Bread Company was centered on its dough-making capabilities. The company guaranteed freshness and high quality in each dough it created. The dough was then passed to the cafes, where it was baked fresh and delivered to the customer. The quality controls within the company were maintained through the entire process to ensure that the customer would be pleased with his purchase. Quality was the basis for success, and quality was what the company relied on to generate loyal customers. Franchising was also a crucial aspect to Panera? s organizational culture because cafes were where the majority of customer contact occurred, and it was the basis for some of management? s values. Panera? s franchising model was extremely stringent, so only certain individuals were able to have cafes. There were eight criteria that had to be met in order to be considered, and a passion for fresh bread was one of them. Panera ensured that each franchisee had the capital and prior knowledge necessary to succeed. The stringent criteria and Panera? s site selection technology provided a strong basis for cafe success, which in turn led to a strong and satisfying organizational culture. Although Panera did not own the franchised cafes, the company dictated where supplies could be obtained to ensure quality. Panera also trained the franchisees so they could operate on their own successfully, but turn to the company for guidance when necessary. The open environment was helpful without it being too overbearing. The strength in the organizational culture was a contributing factor to Panera? success and continued growth. Appendices i. ii. iii. iv. v. SWOT Matrix Stakeholder Matrix Financial Ratios (See attached Excel file) Financial Trend Graphs Responses to Questions Not Answered in the Presentation i. SWOT Matrix STRENGTHS: -Strong and attainable growth strategy -Ability to build a loyal clientele -The business model -Franchising system ; site selection and proprietary software -Research and Develo pment ; Product Innovation -Financial position – lack of long term debt -81% of frequent and moderately frequent customers indicated a willingness to try Panera for multiple meal times WEAKNESSES: -Under utilized potential in promotion strategy -Frequent diners only come at one meal time per day -Only located regionally OPPORTUNITIES: -The industry life cycle is still in growth -Low cost substitutes viewed as lower quality ; value -Large number of small buyers in the industry (Lack of buyer bargaining power) -Buyers are characterized as likely to give new restaurants a try THREATS: -Low switching costs/low customer loyalty -Product is a discretionary purchase -Substitutes are convenient and lower priced -Wide breadth of competitive rivalry -Steep learning curve ii. Stakeholder Matrix Stakeholders Companies, Groups, And Individuals Type/Nature of the Relationship/ What We Do For Each of Them -A chain of cafes perceived as a neighborhood bakerycafe which can be found in various locations around the U. S. and quality is consistent in all locations Needs How We Satisfy Those Needs Customers -U. S. Consumers -A quality food option which is perceived as a good value -A pleasant dining experience with good service and a warm ambiance -By providing quality food in a casual setting that continued to bring customers in for the ambiance and the food -Creating food consumers crave and can trust at all locations Competitors -Independent single-unit establishments with fewer than 20 employees -Competed on a local level, as Panera desired to be seen as the local, neighborhood cafe and gathering place -Fast-casual restaurants -Competed on inviting dining environment, quality of food and enticing menus -Commercial eating institutions -Competed on price, service, ambiance, overall experience and convenience -Provide a successful franchising model to be pursued by highly -Preopening assistance with market -Provided market analysis and site selection assistance, lease review, Employees -Franchisees capitalized, experienced and passionate individuals analysis and site selection, training programs, leadership new store opening assistance, a comprehensive initial training program, and a program for hourly employees, benchmarking data regarding costs and profit margins, company developed marketing and advertising programs, neighborhood marketing assistance Shareholders -Owners of the 31,313 shares outstanding -The community of the regional markets of company and franchised cafes Provided a stable company to invest in -Do not pay dividends -provide a gathering place for locals and visitors and support the community the locations operate in -A food option and company that adds value to its product and the community at large -Panera sponsored local community charity events Community iv. Financial Trend Graphs: Net Income 70000 Net Income (Millions) 60000 50000 40000 30000 20000 10000 0 2002 2003 2004 Year 2005 2006 This figure shows the net income for Panera Bre ad Company from 2002-2006. It depicts a steady increase in net income each year. Net Cash Provided by Operating Activities Nat Cash Provided by Operating Activities (Millions) 120000 100000 80000 60000 40000 20000 0 2002 2003 2004 Year 2005 2006 This figure depicts the net cash provided by operating activities for Panera Bread Company from 2002 to 2006. It shows an increase over time, except from 2005 to 2006. Open Cafes 700 Number of Cafes Open 600 500 400 300 200 100 0 2000 2001 2002 2003 2004 2005 2006 Franchised Cafes Company Owned Cafes Year This figure shows the number of cafes opened at the end of each year. It depicts growth within the company. It also shows that franchise-owned cafes are more prevalent than company-owned ones, which shows success in the company? s franchising model. Store Revenues 2500 Store Revenues (millions) 2000 1500 1000 500 0 2000 2001 2002 2003 Year 2004 2005 2006 This graph shows a steady increase in revenues for each cafe over time. v. Responses to Questions Not Answered in the Presentation: Alterations to Opening Cafes in Untapped and Low Penetrated Markets Recommendation Our recommendation needed to be altered to provide a separate action plan from recommendation to pursue a more aggressive soft-sell promotion strategy. We altered this recommendation by moving Panera? s focus when opening new bakery-cafes using the superior franchising model to solely untapped markets. These untapped markets would allow for sufficient growth to achieve the desired 1:160,000 ratio. Alterations to the More Aggressive Soft-Sell Promotional Strategy Recommendation: Recommendation two needed to be altered from a marketing strategy to a purely promotional strategy. Panera needed to promote its quality menu by implementing the suggested promotional strategies in its bakery cafes. The purpose of the promotional campaign was to bring new customers into the cafes. This satisfied the opportunity within the industry that customers are prone to try newly opened eating establishments in their community. The campaign needed to be implemented in untapped and low-penetrated markets in order to develop brand awareness by attracting new patrons. Though it may help, it will not be as successful in the highly-penetrated markets because Panera is already an established company with high brand awareness and loyal customers. Alterations to Implementation of â€Å"Oven Fresh, To Go† Program Recommendation In response to your concerns regarding recommendation three, we agree that our implementation of â€Å"Oven Fresh, To Go† did not specifically address the low switching cost threat by rewarding return customers for their loyalty. To resolve this issue, we altered the implementation steps to include a punch card in the to-go packaging that would reward existing â€Å"Oven Fresh, To Go† customers for their loyalty and raze their switching costs with progressive discounts based on their level of return patronage. Alterations to Broaden Product Scope Recommendation During the presentation of the recommendations there was concern that recommendation 4 did not adequately address the goal of increasing market share. The primary concern was that offering an expanded dinner menu after 430 pm would not be incentive enough to overcome factors of image, location, and substitutes for Panera to obtain a relevant increase in market share. To bolster the strength of our recommendation and overcome the aforementioned hurdles to success we have amended our recommendation to include the addition of beer and wine at select Panera locations. A Panera site will qualify for alcohol consideration if the area demographics and local legal and regulatory environment are ideal. Selected locations will participate in wine-tasting and other events to engage the surrounding community. The combination of new menu items and select sites serving alcohol will create a new and lively experience for dining at Panera.

Genetic Diversity and QoI Fungicide Resistance

Genetic Diversity and QoI Fungicide Resistance Study of genetic diversity and QoI fungicide resistance in frogeye leaf spot (Cercospora sojina) from Tennessee Introduction Frogeye leaf spot (FLS) of soybean (Glycine max Merr.), caused by the fungal pathogen C. sojina Hara, was first identified in Japan in 1915 and South Carolina, the United States in 1924 (Lehman 1928; Phillips 1999). FLS is an important foliar disease of soybean although symptoms can appear on stems, pods, and seeds. There has been no report of the alternative host in other crops or weeds (Mian et al. 2008). Initial symptom appears as small, light brown circular spot which is later surrounded by darkish brown to reddish circle. (Dashiell and Akem 1991). As the leaves are covered with 50% lesions, leaves start to blight wither and finally falls prematurely. On the lower surface of leaves, the central spot of lesions is somewhat grayish because of conidia produced on conidiophores. Conidia are a primary and secondary source of inoculum and are produced in infected leaves, stems, and pods. Warm temperature and frequent rainfall are suitable factors for severe disease, and fully expanded leaves are more resistant with small lesions as compared to younger leaves (Phillips 1999). The United States is the leading producer of soybean in the world. According to the food and agriculture organization (FAO), the US produced 108 million metric tons of soybeans, second only to corn in 2014 (http://faostat3.fao.org/). FLS is an important disease in most of the soybean growing countries in the world and the main factors hindering the yield includes a reduction in photosynthetic area and premature defoliation of leaves (Mian et al. 2008; Wrather et al. 2010). In the US, FLS is significantly present in Southern warm and humid regions (Mian et al. 2008; Yang et al. 2001). Now, C. sojina is also important to Northern states as the disease was reported in Iowa in 1999, Wisconsin in 2000 (Mengistu et al. 2002) and Ohio in 2006 (Cruz and Dorrance 2009). The damage caused by FLS depends on soybean cultivars and locations, and yield loss has been reported from 10% to more than 60% (Dashiell and Akem 1991; Hartwig and Edwards Jr 1990; Laviolette et al. 1970; Mian et al. 1998). FLS is a polycyclic disease and the disease remains active throughout the growing season (Kim et al. 2013; Laviolette et al. 1970). Dispersal of conidia to some distance is favored by the wind and water splashes (Laviolette et al. 1970). Mycelium of C. sojina can overwinter and a report suggests potential survival of the pathogen in the plant debris for two years (Zhang and Bradley 2014). There are several FLS control methods including cultural practices, use of fungicides and genetic resistance. Primarily, genetic resistance is a most effective measure to control FLS. Till now, three resistant genes Rcs (Resistant to C. sojina), have been deployed: Rcs1 (Athow and Probst 1952), Rcs2 (Athow et al. 1962) and Rcs3 (Phillips and Boerma 1982). The Rcs3 gene confers resistant against race 5 and all known races of C. sojina present in the USA. (Mengistu et al. 2012; Phillips and Boerma 1982). Similarly, crop rotation for two years has been suggested to skip viable inoculum and prevent dise ase severity in the field (Grau et al. 2004; Zhang and Bradley 2014). Further, use of pathogen-free seeds and necessary application of fungicides before flowering to early pod stage have been practiced to decrease disease severity (Grau et al. 2004). Meanwhile, because of change in the pathogen, it has been proven that resistant gene can confer resistance for a certain period and there can be selection against QoI fungicides too (Athow and Probst 1952; Athow et al. 1962; Zeng et al. 2015). There has already been a report of field isolates resistant to QoI fungicides in Tennessee (Zhang et al. 2012). Control measures like use of fungicides and planting of resistant cultivars force pathogens to select against selection pressure. Studies of C. sojina using several approaches indicate diversity among isolates. Because of the lack of universally accepted soybean differentials, its hard to characterize and compare C. sojina isolates. Grau et. al. (2004) have reported 12 races of C. sojina in the US, 22 races in Brazil and 14 races in China. A new set of 12 soybean differentials and 11 races have been proposed based on the reaction of isolates collected from the USA, Brazil, and China (Mian et al. 2008). However, the reaction of 50 isolates from Ohio on the same 12 soybean differentials produced 20 different races (Cruz and Dorrance 2009). There has been a handful of research to characterize C. sojina based on molecular markers. One study includes AFLP based assessment of 62 isolates from Brazil, China, Nigeria and the United States, which showed a significant amount of genetic diversity among isolates, although genotypes did not cluster based on origin. (Bradley et al. 2012). Recently, a study of 132 isolates fr om Arkansas with simple sequence repeat (SSR) has shown the chances of sexual reproduction and high genetic diversity in C. sojina (Kim et al. 2013). The main objectives of this study were to access: genetic diversity by developing and using novel SNP markers and distribution of QoI resistant and sensitive isolates from Jackson and Milan, TN. Sample collection, Single-lesion Isolation, and DNA extraction In 2015, soybean leaves exhibiting typical symptoms of infection with FLS were collected from research plots at two locations in Tennessee (Milan and Jackson). In total, 437 isolates, 203 from Jackson and 234 from Milan, were collected from eight fungicides treated and non-treated Maturity group III soybean cultivars (Table 1). Cultivars were planted in 4 rows (30-inch row spacing), 30 ft long plots in a randomized complete block design with four replications. Plots were split, two rows were not treated, and two rows were treated at R3 growth stage (beginning pod) with Quadris Top SB at 8 fl oz/a (Azoxystrobin and Difenoconazole, Syngenta Corp., Basel, Switzerland). A single isolate of C. sojina was obtained from a single lesion from each leaf. Sporulation was induced by incubating leaves in a plastic bag with moist towels at room temperature. Spores were harvested with a flame-sterilized needle using a dissecting microscope and 8-10 spores transferred to RA-V8 agar media (rifampicin 25 ppm, ampicillin 100 ppm, 160 mL unfiltered V8 juice, 3 gm calcium carbonate and 840 mL water). Observations were made daily and contaminated sectors removed. After seven days, single-lesion isolates of C. sojina were transferred to a new V8 agar media. In addition, a set of 40 isolates from 10 different states, collected before 2015, were included in this study (Table 2). Table 1. Soybean cultivars and number of Cercospora sojina isolates recovered from treated and non-treated cultivars. Cultivar ID Cultivars Jackson Milan Total Treated Non-treated Treated Non-treated C1 VAR Armor 37-R33 RR2 17 11 21 4 53 C2 VAR Asgrow AG3832 GENRR2Y 7 15 20 14 56 C3 VAR Becks 393R4 0 0 0 3 3 C4 VAR Croplan R2C 3984 19 13 11 14 57 C5 VAR Mycogen 5N393R2 RR2 g 12 20 17 28 77 C6 VAR Terral REV 39A35 10 15 13 16 54 C7 VAR USG 73P93R 22 6 13 21 62 C8 VAR Warren Seed 3780 R2Y It 14 22 13 26 75 Table 2. Number of Cercospora sojina isolates collected from Jackson (JTN) and Milan (MTN), Tennessee in 2015 and historical isolates from various states in previous years. Location No. of Samples Year JTN 203 2015 MTN 234 2015 AL 5 2006 AR 5 2006 FL 1 2006 GA 4 2006 IA 1 2006 IL 2 2006/09 LA 1 2006 MS 6 2006 SC 2 2006/2009 TN 12 2007 WI 1 2006 Note: JTN (Jackson) and MTN (Milan) collection in 2015 in Tennessee. TN is a historical collection. For DNA extraction, the single-lesion isolates were grown in 24-well deep well plates (Fisher Scientific) with 1 mL RA-V8 liquid broth (same as above, minus the agar) per well. DNA was extracted as described by Lamour and Finley (2006). Briefly, this includes harvesting mycelium from the broth cultures into a 96-well 2 mL deep well plate pre-loaded with 3-5 sterilized 3 mm glass beads. The plates are freeze dried and the dried mycelium powdered using a Mixer-Mill bead beating device (Qiagen). The powdered mycelium was then lysed and a standard glass fiber spin-column DNA extraction completed. The resulting genomic DNA was visualized on a 1% gel and quantified using a Qubit device. SNP marker discovery and targeted-sequencing based genotyping Whole genome sequencing was accomplished for three FLS isolates from a historical collection originally compiled by Dr. Dan Philips, UGA: FLS11 (CS10117) recovered from Milan, Tennessee in 2010, FLS19 (TN10) from the Georgia Experiment Station, and FLS21 (TN85) which was recovered from Mississippi. Genomic DNA was extracted from freeze-dried and powdered mycelium using a standard phenol-chloroform approach and the resulting DNA was submitted to the Beijing Genomics Institute in China for 2100 paired-end sequencing on an Illumina HiSeq2000 device. De novo assembly, read mapping and SNP discovery was accomplished with CLC Genomics Workbench 7 (Qiagen). As there was no public reference genome available at the time, FLS21 was de novo assembled using the default settings in CLC and the resulting contigs used as a reference genome. All open reading frames (ORFs) longer than 300 amino acids were predicted using CLC and annotated onto the FLS21 contigs. The raw reads from FLS11 and FLS19 wer e then mapped to the draft reference (separately), and putative single nucleotide variants (SNVs) identified at sites with at least 20X coverage and an alternate allele frequency greater than 90%. A subset of the SNVs was chosen from the largest contigs for further genotyping using a targeted sequencing approach. Custom Perl scripts were used to extract the flanking sequences for the panel of SNPs and primers were designed using BatchPrimer3 v1.0 (http://probes.pw.usda.gov/batchprimer3/) to amplify targets between 80 and 120bp in length. Primers for 50 SNPs including mitochondrial QoI resistant locus are summarized in Table 3. Primer sequences and genomic DNA were sent to Floodlight Genomics (Knoxville, TN) for processing as part of a non-profit Educational and Research Outreach Program (EROP) that provides targeted-sequencing services at cost for academic researchers. Floodlight Genomics uses an optimized Hi-Plex approach to amplify targets in multiplex PCR reactions and then sequences the resulting sample-specific amplicons on either an Illumina or Ion NGS device. Resulting sample-specific sequences were mapped to the reference contigs and genotypes assigned for loci with at least 6X coverage. QoI resistant locus genotyping A single nucleotide polymorphism (G/C) in the Cytochrome b gene of the C. sojina mitochondrial genome has been shown to confer resistance to QoI fungicides. A custom TaqMan SNP genotyping assay will be designed using the online design tools from Applied Biosystems (Thermo Scientific) and include the forward primer GGGTTATGTTTTACCTTACGGACAAATG and reverse primer GTCCTACTCATGGTATTGCACTCA and two probes to discriminate resistant and sensitive isolates: ACTGTGGCAGCTCATAA with VIC for the C resistance allele and ACTGTGGCACCTCATAA with FAM for the G sensitive allele (Zeng et al. 2015). Quantitative PCR (qPCR) will be accomplished based on manufacturer instruction using the QuantStudio 6 Flex Real-time PCR System (Thermo Fisher Scientific Inc.). Mating types determination A previously described multiplex PCR assay will be used to assign mating type (MAT1-1-1 or MAT1-2) to a subset of the isolates that had unique multi-locus SNP genotypes (Kim et al. 2013). The MAT1-1-1 locus will be amplified with CsMat1f (5 TGAGGACATGGCCACCCAAATA) and CsMat1r (5 AAGAGCCCTGTCAAGTGTCAGT) and the Mat1-2 locus will be amplified with CsMat2f (5 TGTTGTAGAGCTCGTTGTTCGCA) and CsMat2r (5 TCAGACCTTATGAGCTTGAAAGTGCT) primers (Kim et al. 2013). The assay will be included with the ITS5 (5 GGAAGTAAAAGTCGTAACAAGG) and ITS4 (5 TCCTCCGCTTATTGATATGC ) primers as an internal control to amplify the internal transcribed spacer (ITS) region (White et al. 1990). The resulting PCR products will be visualized under UV light on 2% agarose gel stained with GelRed (Phenix Research Products) and scored based on fragment size of MAT1-1-1 (405 bp) and Mat1-2 (358 bp). Data Analysis SNP loci for each sample will be combined to form a multi-locus SNP genotypes and samples with identical genotype (clonal lineages) will be clone corrected. To assess population structure among the two locations (and in relation to the historical isolates), Bayesian clustering will be accomplished using Structure 2.3.4 (Pritchard et al. 2000). Structure Harvester (Earl 2012) will be used to find the most probable value of K from the results obtained from Structure analysis. Principle coordinate analysis, AMOVA, Nei pairwise genetic distance, Nei pairwise genetic identity and genetic indices will be analyzed with GENALEX (Peakall and Smouse 2006). Phylogenetic clustering of the unique genotypes will be accomplished using Mega 6.06 (Tamura et al. 2013). Minimum spanning networks (Bandelt et al. 1999) will be constructed with PopART (http://popart.otago.ac.nz/). Expected Results Novel SNP markers will be developed and assayed in C. sojina isolates. Population study will help to determine if the isolates from two locations are sub-grouped. The genetic study will also accesses genetic diversity present within and among populations. Molecular identification of mutated cytochrome b site will help to determine the distribution of resistant isolates and contribute to compare resistant isolates in fields between two different time periods. Study of two different mating types in population will help to predict sexual reproduction. References Athow K and Probst AH. 1952. The inheritance of resistance to frog-eye leaf spot of Soybeans. Phytopathology 42(12):660-662 pp. Athow KL, Probst AH, Kurtzman CP and Laviolette FA. 1962. A newly identified physiological race of Cercospora sojina on soybean. Phytopathology 52(7):712-714 pp. Bandelt H-J, Forster P and RÃ ¶hl A. 1999. Median-joining networks for inferring intraspecific phylogenies. Molecular biology and evolution 16(1):37-48. Bradley C, Wood A, Zhang G, Murray J, Phillips D and Ming R. 2012. Genetic diversity of Cercospora sojina revealed by amplified fragment length polymorphism markers. Canadian Journal of Plant Pathology 34(3):410-416. Cruz C and Dorrance A. 2009. Characterization and survival of Cercospora sojina in Ohio. Plant Health Progress doi 10. Dashiell K and Akem C. 1991. Yield losses in soybeans from frogeye leaf spot caused by Cercospora sojina. Crop Protection 10(6):465-468. Earl DA. 2012. STRUCTURE HARVESTER: a website and program for visualizing STRUCTURE output and implementing the Evanno method. Conservation genetics resources 4(2):359-361. Grau CR, Dorrance AE, Bond J and Russin JS. 2004. Fungal diseases. Soybeans: Improvement, production, and uses(soybeansimprove):679-763. Hartwig E and Edwards Jr C. 1990. The uniform soybean tests, southern region, 1989. USDA Mimeographed Rep. US Gov. Print. Office, Washington, DC. Kim H, Newell AD, Cota-Sieckmeyer RG, Rupe JC, Fakhoury AM and Bluhm BH. 2013. Mating-type distribution and genetic diversity of Cercospora sojina populations on soybean from Arkansas: Evidence for potential sexual reproduction. Phytopathology 103(10):1045-1051. Laviolette F, Athow K, Probst A, Wilcox J and Abney T. 1970. Effect of bacterial pustule and frogeye leafspot on yield of Clark soybean. Crop science 10(4):418-419. Lehman S. 1928. Frog-eye leaf spot of Soy Bean caused by Cerco-spora diazu Miara. Journal of Agricultural Research 36(9):811-833. Mengistu A, Bond J, Mian R, Nelson R, Shannon G and Wrather A. 2012. Resistance to Frogeye Leaf Spot in selected soybean accessions in MG I through MG VI. Plant Health Progress 10. Mengistu A, Kurtzweil NC and Grau CR. 2002. First report of Frogeye Leaf Spot (Cercospora sojina) in Wisconsin. Plant Disease 86(11):1272-1272. Mian M, Boerma H, Phillips D, Kenty M, Shannon G, Shipe E, Blount AS and Weaver D. 1998. Performance of frogeye leaf spot-resistant and-susceptible near-isolines of soybean. Plant disease 82(9):1017-1021. Mian M, Missaoui A, Walker D, Phillips D and Boerma H. 2008. Frogeye Leaf Spot of Soybean: A review and proposed race designations for isolates of Hara. Crop science 48(1):14-24. Peakall R and Smouse PE. 2006. GENALEX 6: genetic analysis in Excel. Population genetic software for teaching and research. Molecular ecology notes 6(1):288-295. Phillips D. 1999. Frogeye leaf spot. Compendium of soybean diseases, 4th ed. American Phytopathological Society Press, St. Paul, MN:20-21. Phillips D and Boerma H. 1982. Two genes for resistance to race 5 of Cercospora sojina in soybeans. Phytopathology 72(7):764-766. Pritchard JK, Stephens M and Donnelly P. 2000. Inference of population structure using multilocus genotype data. Genetics 155(2):945-959. Tamura K, Stecher G, Peterson D, Filipski A and Kumar S. 2013. MEGA6: molecular evolutionary genetics analysis version 6.0. Molecular biology and evolution:mst197. White TJ, Bruns T, Lee S and Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols: a guide to methods and applications 18(1):315-322. Wrather A, Shannon G, Balardin R, Carregal L, Escobar R, Gupta G, Ma Z, Morel W, Ploper D and Tenuta A. 2010. Effect of diseases on soybean yield in the top eight producing countries in 2006. Plant Health Progress doi 10:2008-2013. Yang X, Uphoff M and Sanogo S. 2001. Outbreaks of soybean frogeye leaf spot in Iowa. Plant Disease 85(4):443-443. Zeng F, Arnao E, Zhang G, Olaya G, Wullschleger J, Sierotzki H, Ming R, Bluhm B, Bond J and Fakhoury A. 2015. Characterization of quinone outside inhibitor fungicide resistance in Cercospora sojina and development of diagnostic tools for its identification. Plant Disease 99(4):544-550. Zhang G and Bradley CA. 2014. Survival of Cercospora sojina on soybean leaf debris in Illinois. Plant Health Prog 10. Zhang G, Newman M and Bradley C. 2012. First report of the soybean frogeye leaf spot fungus (Cercospora sojina) resistant to quinone outside inhibitor fungicides in North America. Plant Disease 96(5):767-767.